![]() New pipeline, Ultra-low Input mRNA-seq, is available.Īnnouncement of CGC Pilot Grant 2022. Regular scRNA-seq promotion: 10% off the library preparation for cancer project Improve total RNA-seq for the samples with low RIN Webinar with Vizgen: In Situ Single Cell Transcriptomic Imaging in Formalin-fixed Paraffin-embedded (FFPE) Tissues with MERSCOPETM. Webinar with Miltenyi Biotec: Sample prep strategies for optimizing genomic analysis at the single cell level. Webinar with Takara: Pushing the limits of sensitivity for ultra-low and single cell NGS RNA applications. Webinar with 10x Genomics: Bridging histology with genomics Please click the link here for details. New service promotion: 10% off for the library preparation of Visium CytAssist Limited time promotion: 10% off for the library preparation of Ultra-low Input mRNAseq Webinar with Parse Biosciences: Single Cell 3.0: Improving the flexibility, scale, and cost of single cell RNA-Seq. ![]() New pipeline, Ultra-low input total RNAseq, is available (4) Add Truseq Read 2 primer to sequence the UMI (top strand as template, sequence UMI, 10 cycles):ĥ'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXX.Webinar with 10x Genomics: Go where single cell has never gone before. (3) Cluster regeneration, add Sample index sequencing primer (index2) to sequence the sample index (i5) (top strand as template, 8 cycles)::ĥ'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXX.XXXB(pA) NNNNNNNNNN AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC NNNNNNNNNNNNNN ATCTCGTATGCCGTCTTCTGCTTG -3' (2) Add Cell barcode sequencing primer to sequence the cell barcode (bottom strand as template, in this case, cell barcode = i7 index, 14 cycles):ĥ'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-> Step-by-step library generation (1) mRNA capture using Beads-oligo-dT in the droplets, and reverse transcription using MMLV:ĥ'- AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXXXXXXXXXXXXXXXXB(pA) AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ATCTCGTATGCCGTCTTCTGCTTG -3'ģ'- TTCGTCACCATAGTTGCGTCTCATGTACCCXXXXXXXXXXXXXXXXXXXXNV(dT) TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG TAGAGCATACGGCAGAAGACGAAC -5'-|ĥ'- TCTTTCCCTACACGACGCTCTTCCGATCTXXX.XXXB(pA) AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ATCTCGTATGCCGTCTTCTGCTTG*A -3'ģ'- CGAGAAGGCTAGAXXX.XXXV(dT) TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG TAGAGCATACGGCAGAAGACGAAC -5'ģ'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNN TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXX.XXXV(dT) NNNNNNNNNN TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG NNNNNNNNNNNNNN TAGAGCATACGGCAGAAGACGAAC -5' Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3' Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3' Sample index sequencing primer (index2): 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -3' SI-PCR Primer: 5'- AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'Ĭell barcode sequencing primer (index1): 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' Truseq adapter (double stranded DNA with a T overhang): Illumina Truseq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3' Illumina Truseq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3' ISPCR: 5′- AAGCAGTGGTATCAACGCAGAGTACAT -3′ ![]() Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTACATrGrGrG -3' ![]() ![]() This file is copied from Cell Ranger (using Cell Ranger v2.1.0 as an example) /path/to/cellranger-2.1.0/cellranger-cs/2.1.0/tenkit/lib/python/tenkit/barcodes.īeads-oligo-dT: |-5'- CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (T) 30VN -3' You can find out all the cell barcodes (14 bp) here: 737K-april-2014_rc.txt.gz. Based on their the v1 manual PDF and actual data, I think the information in this page is accurate. I cannot find the exact sequence information from the 10x website, so sequences shown here is based on educational guess. The Chromium Single Cell 3’ Solution v1 chemistry is obsolete and superseded by the v2 chemistry. 10x Chromium Single Cell 3' Solution v1 10x Chromium Single Cell 3' Solution v1 ![]()
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |